KLF15 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14780-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KLF15 Reagents
CRO Services
Product recommended

All KLF15 Reagents
KLF15 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1251 bp
Description
Full length Clone DNA of Human Kruppel-like factor 15 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KLF15 cDNA ORF Clone, Human, C-Myc tag Alternative Names
KKLF cDNA ORF Clone, Human
KLF15 Background Information
Full Name
Kruppel-like factor 15

KLF15 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
KLF15 cDNA ORF Clone in Cloning Vector, Rat RG84234-U
KLF15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84234-ACGLN

KLF15 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KLF15 cDNA ORF Clone in Cloning Vector, Mouse MG52214-U
KLF15 cDNA ORF Clone, Mouse, untagged MG52214-UT
KLF15 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52214-ACGLN
KLF15 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52214-ACG
KLF15 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52214-ANG
KLF15 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52214-ACR
KLF15 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52214-ANR
KLF15 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52214-CF
KLF15 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52214-NF
KLF15 cDNA ORF Clone, Mouse, C-His tag MG52214-CH
KLF15 cDNA ORF Clone, Mouse, N-His tag MG52214-NH
KLF15 cDNA ORF Clone, Mouse, C-HA tag MG52214-CY
KLF15 cDNA ORF Clone, Mouse, N-HA tag MG52214-NY
KLF15 cDNA ORF Clone, Mouse, C-Myc tag MG52214-CM
KLF15 cDNA ORF Clone, Mouse, N-Myc tag MG52214-NM
KLF15 qPCR Primer Pairs, Mouse MP202087

KLF15 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KLF15 cDNA ORF Clone in Cloning Vector, Human HG14780-G
KLF15 cDNA ORF Clone, Human, untagged HG14780-UT
KLF15 cDNA ORF Clone, Human, C-GFPSpark® tag HG14780-ACG
KLF15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14780-ACGLN
KLF15 cDNA ORF Clone, Human, N-GFPSpark® tag HG14780-ANG
KLF15 cDNA ORF Clone, Human, C-OFPSpark® tag HG14780-ACR
KLF15 cDNA ORF Clone, Human, N-OFPSpark® tag HG14780-ANR
KLF15 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14780-CF
KLF15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14780-NF
KLF15 cDNA ORF Clone, Human, C-His tag HG14780-CH
KLF15 cDNA ORF Clone, Human, N-His tag HG14780-NH
KLF15 cDNA ORF Clone, Human, C-HA tag HG14780-CY
KLF15 cDNA ORF Clone, Human, N-HA tag HG14780-NY
KLF15 cDNA ORF Clone, Human, N-Myc tag HG14780-NM
KLF15 qPCR Primer Pairs, Human HP103413
info info
添加购物车成功! 添加购物车失败!