Klotho beta cDNA ORF Clone, Human, C-His tag

Cat: HG10568-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Klotho beta Reagents
CRO Services
Product recommended

All Klotho beta Reagents
Klotho beta cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3135 bp
Description
Full length Clone DNA of Human klotho beta with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Klotho beta cDNA ORF Clone, Human, C-His tag Alternative Names
BKL cDNA ORF Clone, Human
Klotho beta Background Information
Full Name
klotho beta

Klotho beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Klotho beta cDNA ORF Clone in Cloning Vector, Mouse MG50661-G
Klotho beta cDNA ORF Clone, Mouse, untagged MG50661-UT
Klotho beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50661-ACG
Klotho beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50661-ACGLN
Klotho beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50661-ACR
Klotho beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50661-CF
Klotho beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50661-NF
Klotho beta cDNA ORF Clone, Mouse, C-His tag MG50661-CH
Klotho beta cDNA ORF Clone, Mouse, N-His tag MG50661-NH
Klotho beta cDNA ORF Clone, Mouse, C-HA tag MG50661-CY
Klotho beta cDNA ORF Clone, Mouse, N-HA tag MG50661-NY
Klotho beta cDNA ORF Clone, Mouse, C-Myc tag MG50661-CM
Klotho beta cDNA ORF Clone, Mouse, N-Myc tag MG50661-NM
Klotho beta qPCR Primer Pairs, Mouse MP200640

Klotho beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Klotho beta cDNA ORF Clone in Cloning Vector, Human HG10568-M
Klotho beta cDNA ORF Clone, Human, untagged HG10568-UT
Klotho beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10568-ACG
Klotho beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10568-ACGLN
Klotho beta cDNA ORF Clone, Human, N-GFPSpark® tag HG10568-ANG
Klotho beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10568-ACR
Klotho beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10568-CF
Klotho beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10568-NF
Klotho beta cDNA ORF Clone, Human, N-His tag HG10568-NH
Klotho beta cDNA ORF Clone, Human, C-HA tag HG10568-CY
Klotho beta cDNA ORF Clone, Human, N-HA tag HG10568-NY
Klotho beta cDNA ORF Clone, Human, C-Myc tag HG10568-CM
Klotho beta cDNA ORF Clone, Human, N-Myc tag HG10568-NM
Klotho beta qPCR Primer Pairs, Human HP100856
info info
添加购物车成功! 添加购物车失败!