KIR2DL3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12828-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All KIR2DL3 Reagents
CRO Services
Product recommended

All KIR2DL3 Reagents
KIR2DL3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1026 bp
Description
Full length Clone DNA of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KIR2DL3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CD158b cDNA ORF Clone, Human;CD158B2 cDNA ORF Clone, Human;CU464054.1 cDNA ORF Clone, Human;GL183 cDNA ORF Clone, Human;KIR-023GB cDNA ORF Clone, Human;KIR-K7b cDNA ORF Clone, Human;KIR-K7c cDNA ORF Clone, Human;KIR2DS5 cDNA ORF Clone, Human;KIRCL23 cDNA ORF Clone, Human;MGC129943 cDNA ORF Clone, Human;NKAT cDNA ORF Clone, Human;NKAT2 cDNA ORF Clone, Human;NKAT2A cDNA ORF Clone, Human;NKAT2B cDNA ORF Clone, Human;p58 cDNA ORF Clone, Human
KIR2DL3 Background Information

Killer cell immunoglobulin-like receptor 2DL3, also known as CD158 antigen-like family member B2, KIR-023GB, Killer inhibitory receptor cl 2-3, MHC class I NK cell receptor, NKAT2a, NKAT2b, Natural killer-associated transcript 2, p58 natural killer cell receptor clone CL-6, p58.2 MHC class-I-specific NK receptor, CD158b2 and KIR2DL3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. KIR2DL3 contains 2 Ig-like C2-type (immunoglobulin-like) domains. KIR2DL3 interacts with ARRB2. KIR2DL3 is a receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). KIR2DL3 inhibits the activity of NK cells thus preventing cell lysis.

Full Name
killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 3
References
  • Selvakumar A., et al., 1997, Immunol. Rev. 155:183-196.
  • Wilson M.J., et al., 1997, Tissue Antigens 49:574-579.
  • Maenaka K., et al., 1999, Structure 7:391-398.
  • Vitale,M. et al., 2004, Int Immunol. 16 (10):1459-66.
  • Yu M.-C., et al., 2008, Nat. Immunol. 9:898-907.
  • info info
    添加购物车成功! 添加购物车失败!