KIN/KIN17 cDNA ORF Clone, Human, N-His tag

Cat: HG14892-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KIN/KIN17 Reagents
CRO Services
Product recommended

All KIN/KIN17 Reagents
KIN/KIN17 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Human KIN, antigenic determinant of recA protein homolog (mouse) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KIN/KIN17 cDNA ORF Clone, Human, N-His tag Alternative Names
BTCD cDNA ORF Clone, Human;KIN17 cDNA ORF Clone, Human;Rts2 cDNA ORF Clone, Human
KIN/KIN17 Background Information
Full Name
Kin17 DNA and RNA binding protein

KIN/KIN17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KIN/KIN17 cDNA ORF Clone in Cloning Vector, Mouse MG59511-U
KIN/KIN17 cDNA ORF Clone, Mouse, untagged MG59511-UT
KIN/KIN17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59511-ACG
KIN/KIN17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59511-ACGLN
KIN/KIN17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59511-ANG
KIN/KIN17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59511-ACR
KIN/KIN17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59511-ANR
KIN/KIN17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59511-CF
KIN/KIN17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59511-NF
KIN/KIN17 cDNA ORF Clone, Mouse, C-His tag MG59511-CH
KIN/KIN17 cDNA ORF Clone, Mouse, N-His tag MG59511-NH
KIN/KIN17 cDNA ORF Clone, Mouse, C-HA tag MG59511-CY
KIN/KIN17 cDNA ORF Clone, Mouse, N-HA tag MG59511-NY
KIN/KIN17 cDNA ORF Clone, Mouse, C-Myc tag MG59511-CM
KIN/KIN17 cDNA ORF Clone, Mouse, N-Myc tag MG59511-NM

KIN/KIN17 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KIN/KIN17 cDNA ORF Clone in Cloning Vector, Human HG14892-G
KIN/KIN17 cDNA ORF Clone, Human, untagged HG14892-UT
KIN/KIN17 cDNA ORF Clone, Human, C-GFPSpark® tag HG14892-ACG
KIN/KIN17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14892-ACGLN
KIN/KIN17 cDNA ORF Clone, Human, N-GFPSpark® tag HG14892-ANG
KIN/KIN17 cDNA ORF Clone, Human, C-OFPSpark® tag HG14892-ACR
KIN/KIN17 cDNA ORF Clone, Human, N-OFPSpark® tag HG14892-ANR
KIN/KIN17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14892-CF
KIN/KIN17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14892-NF
KIN/KIN17 cDNA ORF Clone, Human, C-His tag HG14892-CH
KIN/KIN17 cDNA ORF Clone, Human, C-HA tag HG14892-CY
KIN/KIN17 cDNA ORF Clone, Human, N-HA tag HG14892-NY
KIN/KIN17 cDNA ORF Clone, Human, C-Myc tag HG14892-CM
KIN/KIN17 cDNA ORF Clone, Human, N-Myc tag HG14892-NM
KIN/KIN17 qPCR Primer Pairs, Human HP103521
info info
添加购物车成功! 添加购物车失败!