TIM-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11051-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TIM-1 Reagents
CRO Services
Product recommended

All TIM-1 Reagents
TIM-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human hepatitis A virus cellular receptor 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.12kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TIM-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIM-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
TIM-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD365 cDNA ORF Clone, Human;HACVR cDNA ORF Clone, Human;HAVCR cDNA ORF Clone, Human;HAVCR-1 cDNA ORF Clone, Human;KIM-1 cDNA ORF Clone, Human;KIM1 cDNA ORF Clone, Human;TIM cDNA ORF Clone, Human;TIM-1 cDNA ORF Clone, Human;TIM1 cDNA ORF Clone, Human;TIMD-1 cDNA ORF Clone, Human;TIMD1 cDNA ORF Clone, Human
TIM-1 Background Information

HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

Full Name
hepatitis A virus cellular receptor 1
References
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • TIM-1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    TIM-1 cDNA ORF Clone in Cloning Vector, Canine DG70001-M
    TIM-1 cDNA ORF Clone, Canine, untagged DG70001-UT
    TIM-1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70001-ACGLN
    TIM-1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70001-ACG
    TIM-1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70001-ACR
    TIM-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70001-CF
    TIM-1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70001-NF
    TIM-1 cDNA ORF Clone, Canine, C-His tag DG70001-CH
    TIM-1 cDNA ORF Clone, Canine, N-His tag DG70001-NH
    TIM-1 cDNA ORF Clone, Canine, C-HA tag DG70001-CY
    TIM-1 cDNA ORF Clone, Canine, N-HA tag DG70001-NY
    TIM-1 cDNA ORF Clone, Canine, C-Myc tag DG70001-CM
    TIM-1 cDNA ORF Clone, Canine, N-Myc tag DG70001-NM

    TIM-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TIM-1 cDNA ORF Clone in Cloning Vector, Rat RG80003-M
    TIM-1 cDNA ORF Clone, Rat, untagged RG80003-UT
    TIM-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80003-ACGLN
    TIM-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80003-ACG
    TIM-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80003-ACR
    TIM-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80003-CF
    TIM-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80003-NF
    TIM-1 cDNA ORF Clone, Rat, C-His tag RG80003-CH
    TIM-1 cDNA ORF Clone, Rat, N-His tag RG80003-NH
    TIM-1 cDNA ORF Clone, Rat, C-HA tag RG80003-CY
    TIM-1 cDNA ORF Clone, Rat, N-HA tag RG80003-NY
    TIM-1 cDNA ORF Clone, Rat, C-Myc tag RG80003-CM
    TIM-1 cDNA ORF Clone, Rat, N-Myc tag RG80003-NM
    TIM-1 qPCR Primer Pairs, Rat RP300003

    TIM-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TIM-1 cDNA ORF Clone in Cloning Vector, Mouse MG50321-M
    TIM-1 cDNA ORF Clone, Mouse, untagged MG50321-UT
    TIM-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50321-ACG
    TIM-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50321-ACGLN
    TIM-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50321-ACR
    TIM-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50321-CF
    TIM-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50321-NF
    TIM-1 cDNA ORF Clone, Mouse, C-His tag MG50321-CH
    TIM-1 cDNA ORF Clone, Mouse, N-His tag MG50321-NH
    TIM-1 cDNA ORF Clone, Mouse, C-HA tag MG50321-CY
    TIM-1 cDNA ORF Clone, Mouse, N-HA tag MG50321-NY
    TIM-1 cDNA ORF Clone, Mouse, C-Myc tag MG50321-CM
    TIM-1 cDNA ORF Clone, Mouse, N-Myc tag MG50321-NM
    TIM-1 qPCR Primer Pairs, Mouse MP200344

    TIM-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TIM-1 cDNA ORF Clone in Cloning Vector, Human HG11051-M
    TIM-1 cDNA ORF Clone, Human, untagged HG11051-UT
    TIM-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11051-ACG
    TIM-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11051-ACGLN
    TIM-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11051-ACR
    TIM-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11051-NF
    TIM-1 cDNA ORF Clone, Human, C-His tag HG11051-CH
    TIM-1 cDNA ORF Clone, Human, N-His tag HG11051-NH
    TIM-1 cDNA ORF Clone, Human, C-HA tag HG11051-CY
    TIM-1 cDNA ORF Clone, Human, N-HA tag HG11051-NY
    TIM-1 cDNA ORF Clone, Human, C-Myc tag HG11051-CM
    TIM-1 cDNA ORF Clone, Human, N-Myc tag HG11051-NM
    TIM-1 qPCR Primer Pairs, Human HP100847
    info info
    添加购物车成功! 添加购物车失败!