KIAA0101 cDNA ORF Clone, Human, untagged

Cat: HG14486-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KIAA0101 Reagents
CRO Services
Product recommended

All KIAA0101 Reagents
KIAA0101 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
336 bp
Description
Full length Clone DNA of Human KIAA0101.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KIAA0101 cDNA ORF Clone, Human, untagged Alternative Names
KIAA0101 cDNA ORF Clone, Human;L5 cDNA ORF Clone, Human;NS5ATP9 cDNA ORF Clone, Human;OEATC cDNA ORF Clone, Human;OEATC-1 cDNA ORF Clone, Human;OEATC1 cDNA ORF Clone, Human;p15(PAF) cDNA ORF Clone, Human;p15/PAF cDNA ORF Clone, Human;p15PAF cDNA ORF Clone, Human;PAF cDNA ORF Clone, Human;PAF15 cDNA ORF Clone, Human
KIAA0101 Background Information

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

Full Name
KIAA0101
References
  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • KIAA0101 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    KIAA0101 cDNA ORF Clone in Cloning Vector, Human HG14486-G
    KIAA0101 cDNA ORF Clone in Cloning Vector, Human HG10997-M
    KIAA0101 cDNA ORF Clone, Human, untagged HG10997-UT
    KIAA0101 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14486-ACGLN
    KIAA0101 cDNA ORF Clone, Human, C-GFPSpark® tag HG10997-ACG
    KIAA0101 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10997-ACGLN
    KIAA0101 cDNA ORF Clone, Human, C-GFPSpark® tag HG14486-ACG
    KIAA0101 cDNA ORF Clone, Human, N-GFPSpark® tag HG14486-ANG
    KIAA0101 cDNA ORF Clone, Human, N-GFPSpark® tag HG10997-ANG
    KIAA0101 cDNA ORF Clone, Human, C-OFPSpark® tag HG14486-ACR
    KIAA0101 cDNA ORF Clone, Human, C-OFPSpark® tag HG10997-ACR
    KIAA0101 cDNA ORF Clone, Human, N-OFPSpark® tag HG10997-ANR
    KIAA0101 cDNA ORF Clone, Human, N-OFPSpark® tag HG14486-ANR
    KIAA0101 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14486-CF
    KIAA0101 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10997-CF
    KIAA0101 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10997-NF
    KIAA0101 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14486-NF
    KIAA0101 cDNA ORF Clone, Human, C-His tag HG10997-CH
    KIAA0101 cDNA ORF Clone, Human, C-His tag HG14486-CH
    KIAA0101 cDNA ORF Clone, Human, N-His tag HG10997-NH
    KIAA0101 cDNA ORF Clone, Human, N-His tag HG14486-NH
    KIAA0101 cDNA ORF Clone, Human, C-HA tag HG10997-CY
    KIAA0101 cDNA ORF Clone, Human, C-HA tag HG14486-CY
    KIAA0101 cDNA ORF Clone, Human, N-HA tag HG14486-NY
    KIAA0101 cDNA ORF Clone, Human, N-HA tag HG10997-NY
    KIAA0101 cDNA ORF Clone, Human, C-Myc tag HG10997-CM
    KIAA0101 cDNA ORF Clone, Human, C-Myc tag HG14486-CM
    KIAA0101 cDNA ORF Clone, Human, N-Myc tag HG14486-NM
    KIAA0101 cDNA ORF Clone, Human, N-Myc tag HG10997-NM
    KIAA0101 qPCR Primer Pairs, Human HP100959
    info info
    添加购物车成功! 添加购物车失败!