KEAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11981-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KEAP1 Reagents
CRO Services
Product recommended

All KEAP1 Reagents
KEAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1914 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1413C/G not causing the amino acid variation.
Description
Full length Clone DNA of Human kelch-like ECH-associated protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.91kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
KEAP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KEAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human KEAP1/KEAP-1/INRF2 Gene Expression validated Image 16961
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
KEAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
INRF2 cDNA ORF Clone, Human;KEAP-1 cDNA ORF Clone, Human;KLHL19 cDNA ORF Clone, Human
KEAP1 Background Information

Kelch-like ECH-associated protein 1, also known as cytosolic inhibitor of Nrf2, Kelch-like protein 19, KEAP1 and INRF2, is a cytoplasm and nucleus protein which contains one BACK (BTB/Kelch associated) domain, one BTB (POZ) domain and six Kelch repeats. KEAP1 / INRF2 is broadly expressed, with highest levels in skeletal muscle. KEAP1 / INRF2 is a key regulator of the NRF2 transcription factor, which transactivates the antioxidant response element (ARE) and upregulates numerous proteins involved in antioxidant defense. Under basal conditions, KEAP1 / INRF2 targets NRF2 for ubiquitination and proteolytic degradation and as such is responsible for the rapid turnover of NRF2. KEAP1 / INRF2 retains NFE2L2 / NRF2 in the cytosol. KEAP1 / INRF2 functions as substrate adapter protein for the E3 ubiquitin ligase complex formed by CUL3 and RBX1. It targets NFE2L2 / NRF2 for ubiquitination and degradation by the proteasome, thus resulting in the suppression of its transcriptional activity and the repression of antioxidant response element-mediated detoxifying enzyme gene expression. KEAP1 / INRF2 may also retain BPTF in the cytosol. It targets PGAM5 for ubiquitination and degradation by the proteasome.

Full Name
kelch like ECH associated protein 1
References
  • Strachan GD. et al., 2004, Biochemistry. 43: 12113-22.
  • Zhang DD. et al., 2004, Mol Cell Biol. 24: 10941-53.
  • Zhang DD. et al., 2003, Mol Cell Biol. 23: 8137-51.
  • Lo S-C. et al., 2006, J Biol Chem. 281: 37893-903.
  • Buckley BJ. et al., 2008, Free Radic Biol Med. 44 (4) :692-8.
  • info info
    添加购物车成功! 添加购物车失败!