KDEL Receptor/KDELR1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16244-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KDEL Receptor/KDELR1 Reagents
CRO Services
Product recommended

All KDEL Receptor/KDELR1 Reagents
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KDEL Receptor/KDELR1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ERD2 cDNA ORF Clone, Human;ERD2.1 cDNA ORF Clone, Human;HDEL cDNA ORF Clone, Human;PM23 cDNA ORF Clone, Human
KDEL Receptor/KDELR1 Background Information
Full Name
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1

KDEL Receptor/KDELR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
KDEL Receptor/KDELR1 cDNA ORF Clone in Cloning Vector, Rat RG88654-U
KDEL Receptor/KDELR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88654-ACGLN

KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KDEL Receptor/KDELR1 cDNA ORF Clone in Cloning Vector, Mouse MG53568-G
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, untagged MG53568-UT
KDEL Receptor/KDELR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53568-ACGLN
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53568-ACG
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53568-ACR
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53568-CF
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53568-NF
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, C-His tag MG53568-CH
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, N-His tag MG53568-NH
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, C-HA tag MG53568-CY
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, N-HA tag MG53568-NY
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, C-Myc tag MG53568-CM
KDEL Receptor/KDELR1 cDNA ORF Clone, Mouse, N-Myc tag MG53568-NM

KDEL Receptor/KDELR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KDEL Receptor/KDELR1 cDNA ORF Clone in Cloning Vector, Human HG16244-G
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, untagged HG16244-UT
KDEL Receptor/KDELR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16244-ACGLN
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16244-ACG
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16244-ACR
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16244-CF
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16244-NF
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, C-His tag HG16244-CH
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, N-His tag HG16244-NH
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, C-HA tag HG16244-CY
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, N-HA tag HG16244-NY
KDEL Receptor/KDELR1 cDNA ORF Clone, Human, C-Myc tag HG16244-CM
KDEL Receptor/KDELR1 qPCR Primer Pairs, Human HP105008
info info
添加购物车成功! 添加购物车失败!