KCNMB3 cDNA ORF Clone, Human, N-His tag

Cat: HG13701-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KCNMB3 Reagents
CRO Services
Product recommended

All KCNMB3 Reagents
KCNMB3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
828 bp
Description
Full length Clone DNA of Human potassium large conductance calcium-activated channel, subfamily M beta member 3, transcript variant 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KCNMB3 cDNA ORF Clone, Human, N-His tag Alternative Names
BKBETA3 cDNA ORF Clone, Human;HBETA3 cDNA ORF Clone, Human;K(VCA)BETA-3 cDNA ORF Clone, Human;KCNMB2 cDNA ORF Clone, Human;KCNMBL cDNA ORF Clone, Human;SLO-BETA-3 cDNA ORF Clone, Human;SLOBETA3 cDNA ORF Clone, Human
KCNMB3 Background Information
Full Name
potassium channel subfamily M regulatory beta subunit 3

KCNMB3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KCNMB3 cDNA ORF Clone in Cloning Vector, Human HG13700-G
KCNMB3 cDNA ORF Clone in Cloning Vector, Human HG13701-G
KCNMB3 cDNA ORF Clone, Human, untagged HG13700-UT
KCNMB3 cDNA ORF Clone, Human, untagged HG13701-UT
KCNMB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13700-ACGLN
KCNMB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13701-ACG
KCNMB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13700-ACG
KCNMB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13701-ACGLN
KCNMB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13700-ACR
KCNMB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13701-ACR
KCNMB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13701-CF
KCNMB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13700-CF
KCNMB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13701-NF
KCNMB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13700-NF
KCNMB3 cDNA ORF Clone, Human, C-His tag HG13700-CH
KCNMB3 cDNA ORF Clone, Human, C-His tag HG13701-CH
KCNMB3 cDNA ORF Clone, Human, N-His tag HG13700-NH
KCNMB3 cDNA ORF Clone, Human, C-HA tag HG13701-CY
KCNMB3 cDNA ORF Clone, Human, C-HA tag HG13700-CY
KCNMB3 cDNA ORF Clone, Human, N-HA tag HG13701-NY
KCNMB3 cDNA ORF Clone, Human, N-HA tag HG13700-NY
KCNMB3 cDNA ORF Clone, Human, C-Myc tag HG13700-CM
KCNMB3 cDNA ORF Clone, Human, C-Myc tag HG13701-CM
KCNMB3 cDNA ORF Clone, Human, N-Myc tag HG13700-NM
KCNMB3 cDNA ORF Clone, Human, N-Myc tag HG13701-NM
KCNMB3 qPCR Primer Pairs, Human HP102379
info info
添加购物车成功! 添加购物车失败!