Quick Order

Text Size:AAA

Human CSEN / calsenilin / KCNIP3 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human KCNIP3 cDNA Clone Product Information
NCBI RefSeq:BC012850
RefSeq ORF Size:771bp
cDNA Description:Full length Clone DNA of Homo sapiens Kv channel interacting protein 3, calsenilin with N terminal HA tag.
Gene Synonym:CSEN, DREAM, KCHIP3
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CSEN, also known as calsenilin and KCNIP3, is a member of the family of voltage-gated potassium (Kv) channel-interacting proteins, which belong to the recoverin branch of the EF-hand superfamily. Members of this family are integral subunit components of native Kv4 channel complexes that may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. CSEN also functions as a calcium-regulated transcriptional repressor, and interacts with presenilins. CSEN binds to the DRE element of genes including PDYN and FOS.

Size / Price
Catalog: HG14683-NY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"