Quick Order

Text Size:AAA

Human Junctional Adhesion Molecule B Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human JAM2 cDNA Clone Product Information
NCBI RefSeq:NM_021219.2
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Homo sapiens junctional adhesion molecule 2 with N terminal HA tag.
Gene Synonym:JAMB, CD322, JAM-B, VEJAM, PRO245, VE-JAM, C21orf43
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

References
  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Catalog: HG10580-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"