After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Junctional Adhesion Molecule A Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human F11R cDNA Clone Product Information
NCBI RefSeq:NM_016946.4
RefSeq ORF Size:900bp
cDNA Description:Full length Clone DNA of Homo sapiens F11 receptor (F11R) with N terminal His tag.
Gene Synonym:JAM, F11R, KAT, JAM1, JAMA, JCAM, CD321, JAM-1, JAM-A, PAM-1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

References
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catalog: HG10198-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"