Quick Order

Human JAK2 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human JAK2 cDNA Clone Product Information
NCBI RefSeq:NM_004972.3
RefSeq ORF Size:3399bp
cDNA Description:Full length Clone DNA of Homo sapiens Janus kinase 2 with C terminal His tag.
Gene Synonym:JTK10, JAK2
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-JAK2-His
Restriction Site:KpnI (Three restriction sites) + NotI (6kb + 2.16kb + 0.06kb + 1.22kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 489 C/T and 2490 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human JAK2 Gene Plasmid Map
Human JAK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG11198-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"