Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10379-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Integrin beta 6/ITGB6 Reagents
CRO Services
Product recommended

All Integrin beta 6/ITGB6 Reagents
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2367 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 39A>G and 555C>T not causing the amino acid variation.
Description
Full length Clone DNA of Human integrin, beta 6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb+1.22kb+1.19kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Integrin beta 6/ITGB6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Integrin beta 6/ITGB6 Gene Plasmid Map 5696
Human Integrin beta 6/ITGB6 Gene Expression validated Image 14225
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AI1H cDNA ORF Clone, Human
Integrin beta 6/ITGB6 Background Information
Full Name
integrin, beta 6

Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Integrin beta 6/ITGB6 cDNA ORF Clone in Cloning Vector, Rhesus CG90845-G
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, untagged CG90845-UT
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90845-ACG
Integrin beta 6/ITGB6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90845-ACGLN
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90845-ACR
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90845-CF
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90845-NF
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, C-His tag CG90845-CH
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, N-His tag CG90845-NH
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, C-HA tag CG90845-CY
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, N-HA tag CG90845-NY
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, C-Myc tag CG90845-CM
Integrin beta 6/ITGB6 cDNA ORF Clone, Rhesus, N-Myc tag CG90845-NM

Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin beta 6/ITGB6 cDNA ORF Clone in Cloning Vector, Rat RG81699-G
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, untagged RG81699-UT
Integrin beta 6/ITGB6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81699-ACGLN
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81699-ACG
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81699-ACR
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81699-CF
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81699-NF
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, C-His tag RG81699-CH
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, N-His tag RG81699-NH
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, C-HA tag RG81699-CY
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, N-HA tag RG81699-NY
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, C-Myc tag RG81699-CM
Integrin beta 6/ITGB6 cDNA ORF Clone, Rat, N-Myc tag RG81699-NM

Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin beta 6/ITGB6 cDNA ORF Clone in Cloning Vector, Mouse MG50097-M
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, untagged MG50097-UT
Integrin beta 6/ITGB6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50097-ACGLN
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50097-ACG
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50097-ACR
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50097-CF
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50097-NF
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, C-His tag MG50097-CH
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, N-His tag MG50097-NH
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, C-HA tag MG50097-CY
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, N-HA tag MG50097-NY
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, C-Myc tag MG50097-CM
Integrin beta 6/ITGB6 cDNA ORF Clone, Mouse, N-Myc tag MG50097-NM
Integrin beta 6/ITGB6 qPCR Primer Pairs, Mouse MP200127

Integrin beta 6/ITGB6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin beta 6/ITGB6 cDNA ORF Clone in Cloning Vector, Human HG10379-M
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, untagged HG10379-UT
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10379-ACG
Integrin beta 6/ITGB6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10379-ACGLN
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10379-ACR
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10379-NF
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-His tag HG10379-CH
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, N-His tag HG10379-NH
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-HA tag HG10379-CY
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, N-HA tag HG10379-NY
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, C-Myc tag HG10379-CM
Integrin beta 6/ITGB6 cDNA ORF Clone, Human, N-Myc tag HG10379-NM
Integrin beta 6/ITGB6 qPCR Primer Pairs, Human HP100414
info info
添加购物车成功! 添加购物车失败!