IZUMO1 cDNA ORF Clone, Human, C-His tag

Cat: HG13520-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IZUMO1 Reagents
CRO Services
Product recommended

All IZUMO1 Reagents
IZUMO1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Human izumo sperm-egg fusion 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IZUMO1 cDNA ORF Clone, Human, C-His tag Alternative Names
IZUMO cDNA ORF Clone, Human
IZUMO1 Background Information

Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Izumo1 is essential for sperm-egg plasma membrane binding and fusion.

Full Name
izumo sperm-egg fusion 1
References
  • Inoue N, et al. (2008) Putative sperm fusion protein IZUMO and the role of N-glycosylation. Biochem Biophys Res Commun. 377(3):910-4.
  • Ikram MK, et al. (2010) Four novel Loci (19q13, 6q24, 12q24, and 5q14) influence the microcirculation in vivo. PLoS Genet. 6(10):e1001184.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • info info
    添加购物车成功! 添加购物车失败!