ICAP-1 cDNA ORF Clone, Human, C-His tag

Cat: HG12118-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ICAP-1 Reagents
CRO Services
Product recommended

All ICAP-1 Reagents
ICAP-1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Human integrin beta 1 binding protein 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ICAP-1 cDNA ORF Clone, Human, C-His tag Alternative Names
ICAP-1A cDNA ORF Clone, Human;ICAP-1alpha cDNA ORF Clone, Human;ICAP-1B cDNA ORF Clone, Human;ICAP1 cDNA ORF Clone, Human;ICAP1A cDNA ORF Clone, Human;ICAP1B cDNA ORF Clone, Human
ICAP-1 Background Information
Full Name
integrin beta 1 binding protein 1

ICAP-1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ICAP-1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90438-G
ICAP-1 cDNA ORF Clone, Cynomolgus, untagged CG90438-UT
ICAP-1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90438-ACG
ICAP-1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90438-ACGLN
ICAP-1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90438-ANG
ICAP-1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90438-ACR
ICAP-1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90438-ANR
ICAP-1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90438-CF
ICAP-1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90438-NF
ICAP-1 cDNA ORF Clone, Cynomolgus, C-His tag CG90438-CH
ICAP-1 cDNA ORF Clone, Cynomolgus, N-His tag CG90438-NH
ICAP-1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90438-CY
ICAP-1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90438-NY
ICAP-1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90438-CM
ICAP-1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90438-NM

ICAP-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ICAP-1 cDNA ORF Clone in Cloning Vector, Mouse MG52507-G
ICAP-1 cDNA ORF Clone, Mouse, untagged MG52507-UT
ICAP-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52507-ACGLN
ICAP-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52507-ACG
ICAP-1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52507-ANG
ICAP-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52507-ACR
ICAP-1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52507-ANR
ICAP-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52507-CF
ICAP-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52507-NF
ICAP-1 cDNA ORF Clone, Mouse, C-His tag MG52507-CH
ICAP-1 cDNA ORF Clone, Mouse, N-His tag MG52507-NH
ICAP-1 cDNA ORF Clone, Mouse, C-HA tag MG52507-CY
ICAP-1 cDNA ORF Clone, Mouse, N-HA tag MG52507-NY
ICAP-1 cDNA ORF Clone, Mouse, C-Myc tag MG52507-CM
ICAP-1 cDNA ORF Clone, Mouse, N-Myc tag MG52507-NM
ICAP-1 qPCR Primer Pairs, Mouse MP202380

ICAP-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ICAP-1 cDNA ORF Clone in Cloning Vector, Human HG12118-M
ICAP-1 cDNA ORF Clone, Human, untagged HG12118-UT
ICAP-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12118-ACG
ICAP-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12118-ACGLN
ICAP-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12118-ACR
ICAP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12118-CF
ICAP-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12118-NF
ICAP-1 cDNA ORF Clone, Human, N-His tag HG12118-NH
ICAP-1 cDNA ORF Clone, Human, C-HA tag HG12118-CY
ICAP-1 cDNA ORF Clone, Human, N-HA tag HG12118-NY
ICAP-1 cDNA ORF Clone, Human, C-Myc tag HG12118-CM
ICAP-1 cDNA ORF Clone, Human, N-Myc tag HG12118-NM
ICAP-1 qPCR Primer Pairs, Human HP101645
info info
添加购物车成功! 添加购物车失败!