Quick Order

Human CD11c/ITGAX Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ITGAX cDNA Clone Product Information
NCBI RefSeq:NM_000887.3
RefSeq ORF Size:3492bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha X (complement component 3 receptor 4 subunit).
Gene Synonym:CD11C, SLEB6, ITGAX
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ITGAX
Restriction Site:KpnI + XbaI(6.1kb+3.49kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2538G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGAX qPCR primers for gene expression analysis, HP101649 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12122-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"