Quick Order

Human ITGA4 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ITGA4 cDNA Clone Product Information
NCBI RefSeq:NM_000885.4
RefSeq ORF Size:822bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor).
Gene Synonym:IA4, CD49D, MGC90518, ITGA4
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ITGA4
Restriction Site:HindIII + XbaI (6.1kb + 0.82kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGA4 Gene Plasmid Map
Human ITGA4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"