Quick Order

Human Integrin alpha 4/CD49d/ITGA4 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human ITGA4 cDNA Clone Product Information
NCBI RefSeq:NM_000885.4
RefSeq ORF Size:822bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) with C terminal His tag.
Gene Synonym:IA4, CD49D, MGC90518, ITGA4
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-ITGA4-His
Restriction Site:HindIII + XbaI (6kb + 0.88kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGA4 Gene Plasmid Map
Human ITGA4 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Contact Us
Images
  • Human ITGA4 natural ORF mammalian expression plasmid, C-His tag
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"