Integrin alpha 3 cDNA ORF Clone, Human, N-HA tag

Cat: HG12129-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Integrin alpha 3 Reagents
CRO Services
Product recommended

All Integrin alpha 3 Reagents
Integrin alpha 3 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3156 bp
Description
Full length Clone DNA of Human integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin alpha 3 cDNA ORF Clone, Human, N-HA tag Alternative Names
CD49C cDNA ORF Clone, Human;GAP-B3 cDNA ORF Clone, Human;GAPB3 cDNA ORF Clone, Human;ILNEB cDNA ORF Clone, Human;MSK18 cDNA ORF Clone, Human;VCA-2 cDNA ORF Clone, Human;VL3A cDNA ORF Clone, Human;VLA3a cDNA ORF Clone, Human
Integrin alpha 3 Background Information
Full Name
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)

Integrin alpha 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin alpha 3 cDNA ORF Clone in Cloning Vector, Rat RG80310-G
Integrin alpha 3 cDNA ORF Clone, Rat, untagged RG80310-UT
Integrin alpha 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80310-ACG
Integrin alpha 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80310-ACGLN
Integrin alpha 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80310-ACR
Integrin alpha 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80310-CF
Integrin alpha 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80310-NF
Integrin alpha 3 cDNA ORF Clone, Rat, C-His tag RG80310-CH
Integrin alpha 3 cDNA ORF Clone, Rat, N-His tag RG80310-NH
Integrin alpha 3 cDNA ORF Clone, Rat, C-HA tag RG80310-CY
Integrin alpha 3 cDNA ORF Clone, Rat, N-HA tag RG80310-NY
Integrin alpha 3 cDNA ORF Clone, Rat, C-Myc tag RG80310-CM
Integrin alpha 3 cDNA ORF Clone, Rat, N-Myc tag RG80310-NM
Integrin alpha 3 qPCR Primer Pairs, Rat RP300284

Integrin alpha 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin alpha 3 cDNA ORF Clone in Cloning Vector, Human HG12129-M
Integrin alpha 3 cDNA ORF Clone, Human, untagged HG12129-UT
Integrin alpha 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12129-ACGLN
Integrin alpha 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG12129-ACG
Integrin alpha 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG12129-ACR
Integrin alpha 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12129-CF
Integrin alpha 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12129-NF
Integrin alpha 3 cDNA ORF Clone, Human, C-His tag HG12129-CH
Integrin alpha 3 cDNA ORF Clone, Human, N-His tag HG12129-NH
Integrin alpha 3 cDNA ORF Clone, Human, C-HA tag HG12129-CY
Integrin alpha 3 cDNA ORF Clone, Human, C-Myc tag HG12129-CM
Integrin alpha 3 cDNA ORF Clone, Human, N-Myc tag HG12129-NM
Integrin alpha 3 qPCR Primer Pairs, Human HP101655
info info
添加购物车成功! 添加购物车失败!