ITGA2B/CD41 cDNA ORF Clone, Human, N-His tag

Cat: HG13067-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ITGA2B/CD41 Reagents
CRO Services
Product recommended

All ITGA2B/CD41 Reagents
ITGA2B/CD41 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3120 bp
Description
Full length Clone DNA of Human integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITGA2B/CD41 cDNA ORF Clone, Human, N-His tag Alternative Names
BDPLT16 cDNA ORF Clone, Human;BDPLT2 cDNA ORF Clone, Human;CD41 cDNA ORF Clone, Human;CD41B cDNA ORF Clone, Human;GP2B cDNA ORF Clone, Human;GPIIb cDNA ORF Clone, Human;GT cDNA ORF Clone, Human;GTA cDNA ORF Clone, Human;HPA3 cDNA ORF Clone, Human;PPP1R93 cDNA ORF Clone, Human
ITGA2B/CD41 Background Information
Full Name
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)

ITGA2B/CD41 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ITGA2B/CD41 cDNA ORF Clone in Cloning Vector, Mouse MG51294-G
ITGA2B/CD41 cDNA ORF Clone, Mouse, untagged MG51294-UT
ITGA2B/CD41 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51294-ACGLN
ITGA2B/CD41 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51294-ACG
ITGA2B/CD41 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51294-ACR
ITGA2B/CD41 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51294-CF
ITGA2B/CD41 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51294-NF
ITGA2B/CD41 cDNA ORF Clone, Mouse, C-His tag MG51294-CH
ITGA2B/CD41 cDNA ORF Clone, Mouse, N-His tag MG51294-NH
ITGA2B/CD41 cDNA ORF Clone, Mouse, C-HA tag MG51294-CY
ITGA2B/CD41 cDNA ORF Clone, Mouse, N-HA tag MG51294-NY
ITGA2B/CD41 cDNA ORF Clone, Mouse, C-Myc tag MG51294-CM
ITGA2B/CD41 cDNA ORF Clone, Mouse, N-Myc tag MG51294-NM
ITGA2B/CD41 qPCR Primer Pairs, Mouse MP201175

ITGA2B/CD41 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ITGA2B/CD41 cDNA ORF Clone in Cloning Vector, Human HG13067-G
ITGA2B/CD41 cDNA ORF Clone, Human, untagged HG13067-UT
ITGA2B/CD41 cDNA ORF Clone, Human, C-GFPSpark® tag HG13067-ACG
ITGA2B/CD41 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13067-ACGLN
ITGA2B/CD41 cDNA ORF Clone, Human, C-OFPSpark® tag HG13067-ACR
ITGA2B/CD41 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13067-CF
ITGA2B/CD41 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13067-NF
ITGA2B/CD41 cDNA ORF Clone, Human, C-His tag HG13067-CH
ITGA2B/CD41 cDNA ORF Clone, Human, C-HA tag HG13067-CY
ITGA2B/CD41 cDNA ORF Clone, Human, N-HA tag HG13067-NY
ITGA2B/CD41 cDNA ORF Clone, Human, C-Myc tag HG13067-CM
ITGA2B/CD41 cDNA ORF Clone, Human, N-Myc tag HG13067-NM
ITGA2B/CD41 qPCR Primer Pairs, Human HP101687
info info
添加购物车成功! 添加购物车失败!