ITCH cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11131-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ITCH Reagents
CRO Services
Product recommended

All ITCH Reagents
ITCH cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2589 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human itchy E3 ubiquitin protein ligase homolog (mouse) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + NotI (5.4kb + 2.64kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ITCH cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITCH cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Contactin 1/CNTN1 Gene Plasmid Map 7256
ITCH cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ADMFD cDNA ORF Clone, Human;AIF4 cDNA ORF Clone, Human;AIP4 cDNA ORF Clone, Human;dJ468O1.1 cDNA ORF Clone, Human;NAPP1 cDNA ORF Clone, Human
ITCH Background Information

E3 ubiquitin-protein ligase Itchy homolog, also known as Atrophin-1-interacting protein 4, NFE2-associated polypeptide 1, NAPP1 and ITCH, is a cell membrane protein which contains one C2 domain, one HECT (E6AP-type E3 ubiquitin-protein ligase) domain and contains four WW domains. ITCH acts as an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. It catalyzes 'Lys-29'-, 'Lys-48'- and 'Lys-63'-linked ubiquitin conjugation. ITCH is involved in the control of inflammatory signaling pathways. It is an essential component of a ubiquitin-editing protein complex, comprising also TNFAIP3, TAX1BP1 and RNF11, that ensures the transient nature of inflammatory signaling pathways. ITCH promotes the association of the complex after TNF stimulation. Once the complex is formed, TNFAIP3 deubiquitinates 'Lys-63' polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteosomal degradation and consequently termination of the TNF- or LPS-mediated activation of NFKB1. Defects in ITCH are the cause of syndromic multisystem autoimmune disease (SMAD) which is characterized by organomegaly, failure to thrive, developmental delay, dysmorphic features and autoimmune inflammatory cell infiltration of the lungs, liver and gut.

Full Name
itchy E3 ubiquitin protein ligase
References
  • Marchese A. et al., 2003, Dev. Cell 5:709-22.
  • Wang Y. et al., 2006, EMBO J. 25: 5058-70.
  • Bhandari D. et al., 2009, Mol. Biol. Cell 20:1324-39.
  • Edwards TL. et al., 2009, Biochem. J. 423:31-9.
  • Zhang P. et al., 2010, J. Biol. Chem. 285:8869-79.
  • Azakir B.A. et al., 2010, FEBS J. 277:1319-30.
  • info info
    添加购物车成功! 添加购物车失败!