Islet1/ISL1 cDNA ORF Clone, Human, N-His tag

Cat: HG13122-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Islet1/ISL1 Reagents
CRO Services
Product recommended

All Islet1/ISL1 Reagents
Islet1/ISL1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Human ISL LIM homeobox 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Islet1/ISL1 cDNA ORF Clone, Human, N-His tag Alternative Names
Isl-1 cDNA ORF Clone, Human;ISLET1 cDNA ORF Clone, Human
Islet1/ISL1 Background Information
Full Name
ISL LIM homeobox 1

Islet1/ISL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Islet1/ISL1 cDNA ORF Clone, Mouse, untagged MG56983-UT
Islet1/ISL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56983-ACGLN
Islet1/ISL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG56983-ACR

Islet1/ISL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Islet1/ISL1 cDNA ORF Clone in Cloning Vector, Human HG13122-G
Islet1/ISL1 cDNA ORF Clone in Cloning Vector, Human HG12295-G
Islet1/ISL1 cDNA ORF Clone, Human, untagged HG12295-UT
Islet1/ISL1 cDNA ORF Clone, Human, untagged HG13122-UT
Islet1/ISL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13122-ACG
Islet1/ISL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12295-ACGLN
Islet1/ISL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12295-ACG
Islet1/ISL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13122-ACGLN
Islet1/ISL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12295-ANG
Islet1/ISL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13122-ANG
Islet1/ISL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12295-ACR
Islet1/ISL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13122-ACR
Islet1/ISL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12295-ANR
Islet1/ISL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13122-ANR
Islet1/ISL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12295-CF
Islet1/ISL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13122-CF
Islet1/ISL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12295-NF
Islet1/ISL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13122-NF
Islet1/ISL1 cDNA ORF Clone, Human, C-His tag HG13122-CH
Islet1/ISL1 cDNA ORF Clone, Human, C-His tag HG12295-CH
Islet1/ISL1 cDNA ORF Clone, Human, N-His tag HG12295-NH
Islet1/ISL1 cDNA ORF Clone, Human, C-HA tag HG12295-CY
Islet1/ISL1 cDNA ORF Clone, Human, C-HA tag HG13122-CY
Islet1/ISL1 cDNA ORF Clone, Human, N-HA tag HG12295-NY
Islet1/ISL1 cDNA ORF Clone, Human, N-HA tag HG13122-NY
Islet1/ISL1 cDNA ORF Clone, Human, C-Myc tag HG12295-CM
Islet1/ISL1 cDNA ORF Clone, Human, C-Myc tag HG13122-CM
Islet1/ISL1 cDNA ORF Clone, Human, N-Myc tag HG13122-NM
Islet1/ISL1 cDNA ORF Clone, Human, N-Myc tag HG12295-NM
Islet1/ISL1 qPCR Primer Pairs, Human HP101743
info info
添加购物车成功! 添加购物车失败!