ISCA2/HBLD1 cDNA ORF Clone, Human, N-His tag

Cat: HG14928-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ISCA2/HBLD1 Reagents
CRO Services
Product recommended

All ISCA2/HBLD1 Reagents
ISCA2/HBLD1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Human iron-sulfur cluster assembly 2 homolog (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ISCA2/HBLD1 cDNA ORF Clone, Human, N-His tag Alternative Names
c14_5557 cDNA ORF Clone, Human;HBLD1 cDNA ORF Clone, Human;ISA2 cDNA ORF Clone, Human
ISCA2/HBLD1 Background Information
Full Name
iron-sulfur cluster assembly 2

ISCA2/HBLD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ISCA2/HBLD1 cDNA ORF Clone in Cloning Vector, Mouse MG54673-U
ISCA2/HBLD1 cDNA ORF Clone, Mouse, untagged MG54673-UT
ISCA2/HBLD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54673-ACGLN
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54673-ACG
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54673-ANG
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54673-ACR
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54673-ANR
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54673-CF
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54673-NF
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-His tag MG54673-CH
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-His tag MG54673-NH
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-HA tag MG54673-CY
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-HA tag MG54673-NY
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-Myc tag MG54673-CM
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-Myc tag MG54673-NM

ISCA2/HBLD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ISCA2/HBLD1 cDNA ORF Clone in Cloning Vector, Human HG14928-G
ISCA2/HBLD1 cDNA ORF Clone, Human, untagged HG14928-UT
ISCA2/HBLD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14928-ACGLN
ISCA2/HBLD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14928-ACG
ISCA2/HBLD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14928-ANG
ISCA2/HBLD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14928-ACR
ISCA2/HBLD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14928-ANR
ISCA2/HBLD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14928-CF
ISCA2/HBLD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14928-NF
ISCA2/HBLD1 cDNA ORF Clone, Human, C-His tag HG14928-CH
ISCA2/HBLD1 cDNA ORF Clone, Human, C-HA tag HG14928-CY
ISCA2/HBLD1 cDNA ORF Clone, Human, N-HA tag HG14928-NY
ISCA2/HBLD1 cDNA ORF Clone, Human, C-Myc tag HG14928-CM
ISCA2/HBLD1 cDNA ORF Clone, Human, N-Myc tag HG14928-NM
ISCA2/HBLD1 qPCR Primer Pairs, Human HP103557
info info
添加购物车成功! 添加购物车失败!