INTS4 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14873-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All INTS4 Reagents
CRO Services
Product recommended

All INTS4 Reagents
INTS4 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Description
Full length Clone DNA of Human integrator complex subunit 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

INTS4 cDNA ORF Clone, Human, C-Myc tag Alternative Names
INT4 cDNA ORF Clone, Human;MST093 cDNA ORF Clone, Human
INTS4 Background Information
Full Name
integrator complex subunit 4

INTS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
INTS4 cDNA ORF Clone in Cloning Vector, Mouse MG53070-G
INTS4 cDNA ORF Clone, Mouse, untagged MG53070-UT
INTS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53070-ACG
INTS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53070-ACGLN
INTS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53070-ANG
INTS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53070-ACR
INTS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53070-ANR
INTS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53070-CF
INTS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53070-NF
INTS4 cDNA ORF Clone, Mouse, C-His tag MG53070-CH
INTS4 cDNA ORF Clone, Mouse, N-His tag MG53070-NH
INTS4 cDNA ORF Clone, Mouse, C-HA tag MG53070-CY
INTS4 cDNA ORF Clone, Mouse, N-HA tag MG53070-NY
INTS4 cDNA ORF Clone, Mouse, C-Myc tag MG53070-CM
INTS4 cDNA ORF Clone, Mouse, N-Myc tag MG53070-NM

INTS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
INTS4 cDNA ORF Clone in Cloning Vector, Human HG14873-G
INTS4 cDNA ORF Clone, Human, untagged HG14873-UT
INTS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14873-ACGLN
INTS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14873-ACG
INTS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14873-ANG
INTS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14873-ACR
INTS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14873-ANR
INTS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14873-CF
INTS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14873-NF
INTS4 cDNA ORF Clone, Human, C-His tag HG14873-CH
INTS4 cDNA ORF Clone, Human, N-His tag HG14873-NH
INTS4 cDNA ORF Clone, Human, C-HA tag HG14873-CY
INTS4 cDNA ORF Clone, Human, N-HA tag HG14873-NY
INTS4 cDNA ORF Clone, Human, N-Myc tag HG14873-NM
INTS4 qPCR Primer Pairs, Human HP103504
info info
添加购物车成功! 添加购物车失败!