INMT cDNA ORF Clone, Human, N-HA tag

Cat: HG15812-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All INMT Reagents
CRO Services
Product recommended

All INMT Reagents
INMT cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Human indolethylamine N-methyltransferase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

INMT cDNA ORF Clone, Human, N-HA tag Alternative Names
TEMT cDNA ORF Clone, Human
INMT Background Information
Full Name
indolethylamine N-methyltransferase

INMT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
INMT cDNA ORF Clone in Cloning Vector, Mouse MG5A1079-U
INMT cDNA ORF Clone, Mouse, untagged MG5A1079-UT
INMT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1079-ACGLN
INMT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1079-ACG
INMT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1079-ANG
INMT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1079-ACR
INMT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1079-ANR
INMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1079-CF
INMT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1079-NF
INMT cDNA ORF Clone, Mouse, C-His tag MG5A1079-CH
INMT cDNA ORF Clone, Mouse, N-His tag MG5A1079-NH
INMT cDNA ORF Clone, Mouse, C-HA tag MG5A1079-CY
INMT cDNA ORF Clone, Mouse, N-HA tag MG5A1079-NY
INMT cDNA ORF Clone, Mouse, C-Myc tag MG5A1079-CM
INMT cDNA ORF Clone, Mouse, N-Myc tag MG5A1079-NM

INMT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
INMT cDNA ORF Clone in Cloning Vector, Human HG15812-G
INMT cDNA ORF Clone, Human, untagged HG15812-UT
INMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15812-ACGLN
INMT cDNA ORF Clone, Human, C-GFPSpark® tag HG15812-ACG
INMT cDNA ORF Clone, Human, N-GFPSpark® tag HG15812-ANG
INMT cDNA ORF Clone, Human, C-OFPSpark® tag HG15812-ACR
INMT cDNA ORF Clone, Human, N-OFPSpark® tag HG15812-ANR
INMT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15812-CF
INMT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15812-NF
INMT cDNA ORF Clone, Human, C-His tag HG15812-CH
INMT cDNA ORF Clone, Human, N-His tag HG15812-NH
INMT cDNA ORF Clone, Human, C-HA tag HG15812-CY
INMT cDNA ORF Clone, Human, C-Myc tag HG15812-CM
INMT cDNA ORF Clone, Human, N-Myc tag HG15812-NM
INMT qPCR Primer Pairs, Human HP104403
info info
添加购物车成功! 添加购物车失败!