Inhibin beta A cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human inhibin, beta A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb+1.09kb+0.24kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**
Inhibin beta A cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Inhibin beta A cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
EDF cDNA ORF Clone, Human;FRP cDNA ORF Clone, Human
Inhibin beta A Background Information
Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two β subunits, βA βA (activin A), βB βB (activin B), or βA βB (activin AB). Inhibin is composed of an alpha and one of two β subunits, βA (inhibin A) or βB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.
Full Name
inhibin, beta A
References
Tanimoto K, et al. (1992) Structure and sequence analysis of the human activin beta A subunit gene. DNA Seq. 2 (2): 103-10.Welt C, et al. (2002) Activins, inhibins, and follistatins: from endocrinology to signaling. A paradigm for the new millennium. Exp Biol Med. 227 (9): 724-52.Xu J, et al. (1995) Inhibin antagonizes inhibition of liver cell growth by activin by a dominant-negative mechanism. J Biol Chem. 270 (11): 6308-13.
