Inhibin alpha/INHA cDNA ORF Clone, Human, C-HA tag

Cat: HG10531-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Inhibin alpha/INHA Reagents
CRO Services
Product recommended

All Inhibin alpha/INHA Reagents
Inhibin alpha/INHA cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1101 bp
Description
Full length Clone DNA of Human inhibin, alpha with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Inhibin alpha/INHA Background Information
Full Name
inhibin, alpha

Inhibin alpha/INHA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Inhibin alpha/INHA cDNA ORF Clone in Cloning Vector, Mouse MG53922-U
Inhibin alpha/INHA cDNA ORF Clone, Mouse, untagged MG53922-UT
Inhibin alpha/INHA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53922-ACG
Inhibin alpha/INHA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53922-ACGLN
Inhibin alpha/INHA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53922-ACR
Inhibin alpha/INHA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53922-CF
Inhibin alpha/INHA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53922-NF
Inhibin alpha/INHA cDNA ORF Clone, Mouse, C-His tag MG53922-CH
Inhibin alpha/INHA cDNA ORF Clone, Mouse, N-His tag MG53922-NH
Inhibin alpha/INHA cDNA ORF Clone, Mouse, C-HA tag MG53922-CY
Inhibin alpha/INHA cDNA ORF Clone, Mouse, N-HA tag MG53922-NY
Inhibin alpha/INHA cDNA ORF Clone, Mouse, C-Myc tag MG53922-CM
Inhibin alpha/INHA cDNA ORF Clone, Mouse, N-Myc tag MG53922-NM

Inhibin alpha/INHA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Inhibin alpha/INHA cDNA ORF Clone in Cloning Vector, Human HG10531-M
Inhibin alpha/INHA cDNA ORF Clone, Human, untagged HG10531-UT
Inhibin alpha/INHA cDNA ORF Clone, Human, C-GFPSpark® tag HG10531-ACG
Inhibin alpha/INHA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10531-ACGLN
Inhibin alpha/INHA cDNA ORF Clone, Human, C-OFPSpark® tag HG10531-ACR
Inhibin alpha/INHA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10531-CF
Inhibin alpha/INHA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10531-NF
Inhibin alpha/INHA cDNA ORF Clone, Human, C-His tag HG10531-CH
Inhibin alpha/INHA cDNA ORF Clone, Human, N-His tag HG10531-NH
Inhibin alpha/INHA cDNA ORF Clone, Human, N-HA tag HG10531-NY
Inhibin alpha/INHA cDNA ORF Clone, Human, C-Myc tag HG10531-CM
Inhibin alpha/INHA cDNA ORF Clone, Human, N-Myc tag HG10531-NM
Inhibin alpha/INHA qPCR Primer Pairs, Human HP100548
info info
添加购物车成功! 添加购物车失败!