IMPDH2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14878-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IMPDH2 Reagents
CRO Services
Product recommended

All IMPDH2 Reagents
IMPDH2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545 bp
Description
Full length Clone DNA of Human IMP (inosine 5'-monophosphate) dehydrogenase 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IMPDH2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
IMPD2 cDNA ORF Clone, Human;IMPDH-II cDNA ORF Clone, Human
IMPDH2 Background Information
Full Name
IMP (inosine 5'-monophosphate) dehydrogenase 2

IMPDH2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IMPDH2 cDNA ORF Clone in Cloning Vector, Rat RG80538-U
IMPDH2 cDNA ORF Clone, Rat, untagged RG80538-UT
IMPDH2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80538-ACG
IMPDH2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80538-ACGLN
IMPDH2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80538-ANG
IMPDH2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80538-ACR
IMPDH2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80538-ANR
IMPDH2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80538-CF
IMPDH2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80538-NF
IMPDH2 cDNA ORF Clone, Rat, C-His tag RG80538-CH
IMPDH2 cDNA ORF Clone, Rat, N-His tag RG80538-NH
IMPDH2 cDNA ORF Clone, Rat, C-HA tag RG80538-CY
IMPDH2 cDNA ORF Clone, Rat, N-HA tag RG80538-NY
IMPDH2 cDNA ORF Clone, Rat, C-Myc tag RG80538-CM
IMPDH2 cDNA ORF Clone, Rat, N-Myc tag RG80538-NM
IMPDH2 qPCR Primer Pairs, Rat RP300502

IMPDH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IMPDH2 cDNA ORF Clone in Cloning Vector, Mouse MG52562-G
IMPDH2 cDNA ORF Clone, Mouse, untagged MG52562-UT
IMPDH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52562-ACG
IMPDH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52562-ACGLN
IMPDH2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52562-ANG
IMPDH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52562-ACR
IMPDH2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52562-ANR
IMPDH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52562-CF
IMPDH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52562-NF
IMPDH2 cDNA ORF Clone, Mouse, C-His tag MG52562-CH
IMPDH2 cDNA ORF Clone, Mouse, N-His tag MG52562-NH
IMPDH2 cDNA ORF Clone, Mouse, C-HA tag MG52562-CY
IMPDH2 cDNA ORF Clone, Mouse, N-HA tag MG52562-NY
IMPDH2 cDNA ORF Clone, Mouse, C-Myc tag MG52562-CM
IMPDH2 cDNA ORF Clone, Mouse, N-Myc tag MG52562-NM
IMPDH2 qPCR Primer Pairs, Mouse MP202434

IMPDH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IMPDH2 cDNA ORF Clone in Cloning Vector, Human HG14878-G
IMPDH2 cDNA ORF Clone, Human, untagged HG14878-UT
IMPDH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14878-ACGLN
IMPDH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14878-ACG
IMPDH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14878-ANG
IMPDH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14878-ACR
IMPDH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14878-ANR
IMPDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14878-CF
IMPDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14878-NF
IMPDH2 cDNA ORF Clone, Human, C-His tag HG14878-CH
IMPDH2 cDNA ORF Clone, Human, N-His tag HG14878-NH
IMPDH2 cDNA ORF Clone, Human, C-HA tag HG14878-CY
IMPDH2 cDNA ORF Clone, Human, N-HA tag HG14878-NY
IMPDH2 cDNA ORF Clone, Human, N-Myc tag HG14878-NM
IMPDH2 qPCR Primer Pairs, Human HP103508
info info
添加购物车成功! 添加购物车失败!