After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ILK cDNA Clone Product Information
NCBI RefSeq:NM_001014794.1
RefSeq ORF Size:1359bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin-linked kinase.
Gene Synonym:P59, DKFZp686F1765, ILK
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid on other vectors
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10736-ACG$225
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10736-ACR$225
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10736-ANG$225
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10736-ANR$225
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-Flag tagHG10736-CF$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-His tagHG10736-CH$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-Myc tagHG10736-CM$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-HA tagHG10736-CY$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone in cloning vectorHG10736-M$75
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, C-Flag tagHG10736-M-F$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, N-Flag tagHG10736-NF$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, N-His tagHG10736-NH$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, N-Myc tagHG10736-NM$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmid, N-HA tagHG10736-NY$195
Human ILK / Integrin Linked Kinase Gene ORF cDNA clone expression plasmidHG10736-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10736-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"