IL-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11821-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL-7 Reagents
CRO Services
Product recommended

All IL-7 Reagents
IL-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
534 bp
Description
Full length Clone DNA of Human interleukin 7 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
IL-7 cDNA ORF Clone, Human;Interleukin-7 cDNA ORF Clone, Human
IL-7 Background Information

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 7
References
  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • IL-7 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-7 cDNA ORF Clone in Cloning Vector, Rhesus CG90128-G
    IL-7 cDNA ORF Clone, Rhesus, untagged CG90128-UT
    IL-7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90128-ACGLN
    IL-7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90128-ACG
    IL-7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90128-ACR
    IL-7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90128-CF
    IL-7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90128-NF
    IL-7 cDNA ORF Clone, Rhesus, C-His tag CG90128-CH
    IL-7 cDNA ORF Clone, Rhesus, N-His tag CG90128-NH
    IL-7 cDNA ORF Clone, Rhesus, C-HA tag CG90128-CY
    IL-7 cDNA ORF Clone, Rhesus, N-HA tag CG90128-NY
    IL-7 cDNA ORF Clone, Rhesus, C-Myc tag CG90128-CM
    IL-7 cDNA ORF Clone, Rhesus, N-Myc tag CG90128-NM

    IL-7 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-7 cDNA ORF Clone in Cloning Vector, Rat RG80329-G
    IL-7 cDNA ORF Clone, Rat, untagged RG80329-UT
    IL-7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80329-ACGLN
    IL-7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80329-ACG
    IL-7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80329-ACR
    IL-7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80329-CF
    IL-7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80329-NF
    IL-7 cDNA ORF Clone, Rat, C-His tag RG80329-CH
    IL-7 cDNA ORF Clone, Rat, N-His tag RG80329-NH
    IL-7 cDNA ORF Clone, Rat, C-HA tag RG80329-CY
    IL-7 cDNA ORF Clone, Rat, N-HA tag RG80329-NY
    IL-7 cDNA ORF Clone, Rat, C-Myc tag RG80329-CM
    IL-7 cDNA ORF Clone, Rat, N-Myc tag RG80329-NM
    IL-7 qPCR Primer Pairs, Rat RP300300

    IL-7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-7 cDNA ORF Clone in Cloning Vector, Mouse MG50217-M
    IL-7 cDNA ORF Clone, Mouse, untagged MG50217-UT
    IL-7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50217-ACG
    IL-7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50217-ACGLN
    IL-7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50217-ACR
    IL-7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50217-CF
    IL-7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50217-NF
    IL-7 cDNA ORF Clone, Mouse, C-His tag MG50217-CH
    IL-7 cDNA ORF Clone, Mouse, N-His tag MG50217-NH
    IL-7 cDNA ORF Clone, Mouse, C-HA tag MG50217-CY
    IL-7 cDNA ORF Clone, Mouse, N-HA tag MG50217-NY
    IL-7 cDNA ORF Clone, Mouse, C-Myc tag MG50217-CM
    IL-7 cDNA ORF Clone, Mouse, N-Myc tag MG50217-NM
    IL-7 qPCR Primer Pairs, Mouse MP200244

    IL-7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-7 cDNA ORF Clone in Cloning Vector, Human HG11821-G
    IL-7 cDNA ORF Clone, Human, untagged HG11821-UT
    IL-7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11821-ACGLN
    IL-7 cDNA ORF Clone, Human, C-GFPSpark® tag HG11821-ACG
    IL-7 cDNA ORF Clone, Human, C-OFPSpark® tag HG11821-ACR
    IL-7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11821-NF
    IL-7 cDNA ORF Clone, Human, C-His tag HG11821-CH
    IL-7 cDNA ORF Clone, Human, N-His tag HG11821-NH
    IL-7 cDNA ORF Clone, Human, C-HA tag HG11821-CY
    IL-7 cDNA ORF Clone, Human, N-HA tag HG11821-NY
    IL-7 cDNA ORF Clone, Human, C-Myc tag HG11821-CM
    IL-7 cDNA ORF Clone, Human, N-Myc tag HG11821-NM
    IL-7 qPCR Primer Pairs, Human HP103200
    info info
    添加购物车成功! 添加购物车失败!