IL-6R cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10398-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-6R Reagents
CRO Services
Product recommended

All IL-6R Reagents
IL-6R cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 6 receptor, transcript variant 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.46kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL-6R cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-6R cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
IL-6R cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD126 cDNA ORF Clone, Human;gp80 cDNA ORF Clone, Human;IL-6R cDNA ORF Clone, Human;IL-6R-1 cDNA ORF Clone, Human;IL-6RA cDNA ORF Clone, Human;IL6Q cDNA ORF Clone, Human;IL6RA cDNA ORF Clone, Human;IL6RQ cDNA ORF Clone, Human
IL-6R Background Information

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 6 receptor
References
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • IL-6R cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-6R cDNA ORF Clone in Cloning Vector, Rhesus CG90324-G
    IL-6R cDNA ORF Clone, Rhesus, untagged CG90324-UT
    IL-6R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90324-ACGLN
    IL-6R cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90324-ACG
    IL-6R cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90324-ACR
    IL-6R cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90324-CF
    IL-6R cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90324-NF
    IL-6R cDNA ORF Clone, Rhesus, C-His tag CG90324-CH
    IL-6R cDNA ORF Clone, Rhesus, N-His tag CG90324-NH
    IL-6R cDNA ORF Clone, Rhesus, C-HA tag CG90324-CY
    IL-6R cDNA ORF Clone, Rhesus, N-HA tag CG90324-NY
    IL-6R cDNA ORF Clone, Rhesus, C-Myc tag CG90324-CM
    IL-6R cDNA ORF Clone, Rhesus, N-Myc tag CG90324-NM

    IL-6R cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-6R cDNA ORF Clone in Cloning Vector, Canine DG70117-G

    IL-6R cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-6R cDNA ORF Clone in Cloning Vector, Rat RG81072-G

    IL-6R cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-6R cDNA ORF Clone in Cloning Vector, Mouse MG50280-M
    IL-6R cDNA ORF Clone, Mouse, untagged MG50280-UT
    IL-6R cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50280-ACG
    IL-6R Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50280-ACGLN
    IL-6R cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50280-ACR
    IL-6R cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50280-CF
    IL-6R cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50280-NF
    IL-6R cDNA ORF Clone, Mouse, C-His tag MG50280-CH
    IL-6R cDNA ORF Clone, Mouse, N-His tag MG50280-NH
    IL-6R cDNA ORF Clone, Mouse, C-HA tag MG50280-CY
    IL-6R cDNA ORF Clone, Mouse, N-HA tag MG50280-NY
    IL-6R cDNA ORF Clone, Mouse, C-Myc tag MG50280-CM
    IL-6R cDNA ORF Clone, Mouse, N-Myc tag MG50280-NM
    IL-6R qPCR Primer Pairs, Mouse MP200304

    IL-6R cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-6R cDNA ORF Clone in Cloning Vector, Human HG10398-M
    IL-6R cDNA ORF Clone, Human, untagged HG10398-UT
    IL-6R cDNA ORF Clone, Human, C-GFPSpark® tag HG10398-ACG
    IL-6R Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10398-ACGLN
    IL-6R cDNA ORF Clone, Human, C-OFPSpark® tag HG10398-ACR
    IL-6R cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10398-NF
    IL-6R cDNA ORF Clone, Human, C-His tag HG10398-CH
    IL-6R cDNA ORF Clone, Human, N-His tag HG10398-NH
    IL-6R cDNA ORF Clone, Human, C-HA tag HG10398-CY
    IL-6R cDNA ORF Clone, Human, N-HA tag HG10398-NY
    IL-6R cDNA ORF Clone, Human, C-Myc tag HG10398-CM
    IL-6R cDNA ORF Clone, Human, N-Myc tag HG10398-NM
    IL-6R qPCR Primer Pairs, Human HP100045
    info info
    添加购物车成功! 添加购物车失败!