IL-6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10395-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-6 Reagents
CRO Services
Product recommended

All IL-6 Reagents
IL-6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 6 (interferon, beta 2) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + NotI (6kb + 0.69kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL-6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human IL6/IL-6/Interleukin-6 Gene Expression validated Image 1526
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Cynomolgus CDCP1 Gene Plasmid Map 5627
IL-6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BSF2 cDNA ORF Clone, Human;HGF cDNA ORF Clone, Human;HSF cDNA ORF Clone, Human;IFNB2 cDNA ORF Clone, Human;IL-6 cDNA ORF Clone, Human;Interleukin-6 cDNA ORF Clone, Human
IL-6 Background Information

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 6
References
  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.
  • IL-6 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-6 cDNA ORF Clone in Cloning Vector, Canine DG70015-G
    IL-6 cDNA ORF Clone in Cloning Vector, Canine DG70243-G
    IL-6 cDNA ORF Clone, Canine, untagged DG70015-UT
    IL-6 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70015-ACG
    IL-6 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70015-ACGLN
    IL-6 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70015-ACR
    IL-6 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70015-CF
    IL-6 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70015-NF
    IL-6 cDNA ORF Clone, Canine, C-His tag DG70015-CH
    IL-6 cDNA ORF Clone, Canine, N-His tag DG70015-NH
    IL-6 cDNA ORF Clone, Canine, C-HA tag DG70015-CY
    IL-6 cDNA ORF Clone, Canine, N-HA tag DG70015-NY
    IL-6 cDNA ORF Clone, Canine, C-Myc tag DG70015-CM
    IL-6 cDNA ORF Clone, Canine, N-Myc tag DG70015-NM

    IL-6 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-6 cDNA ORF Clone in Cloning Vector, Rhesus CG90197-G
    IL-6 cDNA ORF Clone, Rhesus, untagged CG90197-UT
    IL-6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90197-ACG
    IL-6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90197-ACGLN
    IL-6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90197-ACR
    IL-6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90197-CF
    IL-6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90197-NF
    IL-6 cDNA ORF Clone, Rhesus, C-His tag CG90197-CH
    IL-6 cDNA ORF Clone, Rhesus, N-His tag CG90197-NH
    IL-6 cDNA ORF Clone, Rhesus, C-HA tag CG90197-CY
    IL-6 cDNA ORF Clone, Rhesus, N-HA tag CG90197-NY
    IL-6 cDNA ORF Clone, Rhesus, C-Myc tag CG90197-CM
    IL-6 cDNA ORF Clone, Rhesus, N-Myc tag CG90197-NM

    IL-6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-6 cDNA ORF Clone in Cloning Vector, Rat RG80076-M
    IL-6 cDNA ORF Clone, Rat, untagged RG80076-UT
    IL-6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80076-ACGLN
    IL-6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80076-ACG
    IL-6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80076-ACR
    IL-6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80076-CF
    IL-6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80076-NF
    IL-6 cDNA ORF Clone, Rat, C-His tag RG80076-CH
    IL-6 cDNA ORF Clone, Rat, N-His tag RG80076-NH
    IL-6 cDNA ORF Clone, Rat, C-HA tag RG80076-CY
    IL-6 cDNA ORF Clone, Rat, N-HA tag RG80076-NY
    IL-6 cDNA ORF Clone, Rat, C-Myc tag RG80076-CM
    IL-6 cDNA ORF Clone, Rat, N-Myc tag RG80076-NM
    IL-6 qPCR Primer Pairs, Rat RP300072

    IL-6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-6 cDNA ORF Clone in Cloning Vector, Mouse MG50136-M
    IL-6 cDNA ORF Clone, Mouse, untagged MG50136-UT
    IL-6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50136-ACG
    IL-6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50136-ACGLN
    IL-6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50136-ACR
    IL-6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50136-CF
    IL-6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50136-NF
    IL-6 cDNA ORF Clone, Mouse, C-His tag MG50136-CH
    IL-6 cDNA ORF Clone, Mouse, N-His tag MG50136-NH
    IL-6 cDNA ORF Clone, Mouse, C-HA tag MG50136-CY
    IL-6 cDNA ORF Clone, Mouse, N-HA tag MG50136-NY
    IL-6 cDNA ORF Clone, Mouse, C-Myc tag MG50136-CM
    IL-6 cDNA ORF Clone, Mouse, N-Myc tag MG50136-NM
    IL-6 qPCR Primer Pairs, Mouse MP200166

    IL-6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-6 cDNA ORF Clone in Cloning Vector, Human HG10395-M
    IL-6 cDNA ORF Clone, Human, untagged HG10395-UT
    IL-6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10395-ACG
    IL-6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10395-ACGLN
    IL-6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10395-ACR
    IL-6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10395-NF
    IL-6 cDNA ORF Clone, Human, C-His tag HG10395-CH
    IL-6 cDNA ORF Clone, Human, N-His tag HG10395-NH
    IL-6 cDNA ORF Clone, Human, C-HA tag HG10395-CY
    IL-6 cDNA ORF Clone, Human, N-HA tag HG10395-NY
    IL-6 cDNA ORF Clone, Human, C-Myc tag HG10395-CM
    IL-6 cDNA ORF Clone, Human, N-Myc tag HG10395-NM
    IL-6 qPCR Primer Pairs, Human HP100427
    info info
    添加购物车成功! 添加购物车失败!