Quick Order

Human IL-1F6 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human IL36A cDNA Clone Product Information
NCBI RefSeq:NM_014440.1
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 family, member 6 (epsilon) with N terminal HA tag.
Gene Synonym:FIL1, FIL1E, IL-1F6, MGC129552, MGC129553, IL1(EPSILON), FIL1(EPSILON)
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interleukin-1 family member 6 (IL-1F6), also known as interleukin 36, alpha (IL36A), is a pro-inflammatory cytokine which plays an important role in innate and adaptive immunity. IL-1F6 activates MAPK and NF-kB pathways and is produced by many different cells. This cytokine is a family member of interleukin-1 (IL-1) and plays an important role in the pathophysiology of several diseases. It has been reported that IL-1F6 and IL-1F8, in addition to IL-1F9, activate the pathway leading to NF-kappaB in an IL-1Rrp2-dependent manner in Jurkat cells as well as in multiple other human and mouse cell lines. Activation of the pathway leading to NF-kappaB by IL-1F6 and IL-1F8 follows a similar time course to activation by IL-1beta, suggesting that signaling by the novel family members occurs through a direct mechanism. In a mammary epithelial cell line, NCI/ADR-RES, which naturally expresses IL-1Rrp2, all three cytokines signal without further receptor transfection. IL-1Rrp2 antibodies block activation of the pathway leading to NF-kappaB by IL-1F6, IL-1F8, and IL-1F9 in both Jurkat and NCI/ADR-RES cells. Thus IL-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP.

References
  • Tripodi D, et al. (2012) IL-36 a new member of the IL-1 family cytokines. J Biol Regul Homeost Agents. 26(1):7-14.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Kumar S, et al. (2000) Identification and initial characterization of four novel members of the interleukin-1 family. J Biol Chem. 275(14): 10308-14.
  • Size / Price
    Catalog: HG10607-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"