Quick Order

Human IL32 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL32 cDNA Clone Product Information
NCBI RefSeq:NM_004221.4
RefSeq ORF Size:567bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 32 with N terminal His tag.
Gene Synonym:NK4, TAIF, TAIFa, TAIFb, TAIFc, TAIFd, IL-32beta, IL-32alpha, IL-32delta, IL-32gamma, IL32
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

IL-32 is a recently discovered cytokine that induces various proinflammatory cytokines (TNF-alpha, IL-1beta, IL-6) and chemokines in both human and mouse cells through the NF-kappaB and p38 MAPK inflammatory signal pathways. It is regulated robustly by other major proinflammatory cytokines, and is crucial to inflammation and immune responses. Four of the IL-32 isoforms (alpha, beta, gamma and delta) are the most representative IL-32 transcripts, and gamma isoform of IL-32 is the most active, although all isoforms are biologically active. IL-32, a cytokine produced mainly by T, natural killer, and epithelial cells induces significant amounts of TNFalpha and MIP-2 and increases the production of both cytokines in a dose-dependent manner. IL-32 has been implicated in inflammatory disorders, mycobacterium tuberculosis infections, inflammatory bowel disease, and influenza A virus infection, as well as in some autoimmune diseases, such as rheumatoid arthritis, ulcerative colitis and in human stomach cancer, human lung cancer and breast cancer tissues. Thus, IL-32 expression might be valuable as a biomarker for cancer.

References
  • Felaco P, et al. (2009) IL-32: a newly-discovered proinflammatory cytokine. J Biol Regul Homeost Agents. 23(3): 141-7.
  • Kobayashi H, et al. (2009) Molecular characterization of IL-32 in human endothelial cells. Cytokine. 46(3): 351-8.
  • Meyer N, et al. (2010) IL-32 is expressed by human primary keratinocytes and modulates keratinocyte apoptosis in atopic dermatitis. J Allergy Clin Immunol. 125(4): 858-865.
  • Size / Price
    Catalog: HG10860-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"