Quick Order

Human CD132 / IL2RG Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL2RG cDNA Clone Product Information
NCBI RefSeq:NM_000206.1
RefSeq ORF Size:1110bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 2 receptor, gamma (severe combined immunodeficiency) with C terminal His tag.
Gene Synonym:IMD4, CD132, SCIDX, SCIDX1
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-IL2RG-His
Restriction Site:KpnI + XbaI (6kb + 1.16kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL2RG Gene Plasmid Map
Human IL2Rg natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

References
  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"