After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human WSX-1/IL-27R Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IL27RA cDNA Clone Product Information
NCBI RefSeq:NM_004843.2
RefSeq ORF Size:1911bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 27 receptor, alpha with C terminal Flag tag.
Gene Synonym:CRL1, TCCR, WSX1, IL27R, zcytor1, IL27RA
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The interleukin-27 receptor is a type I cytokine receptor for interleukin-27. It is a heterodimer composed of the interleukin 27 receptor, alpha subunit and glycoprotein 130. WSX-1/IL-27R, a class I cytokine receptor that is homologous to the β2 chain of the IL-12R in both sequence and structure, is highly expressed by resting/naive CD4+ T cells and CD8+ T cells. WSX-1/IL-27R belongs to the IL-6/IL-12 family of cytokines and induced proliferation of naive CD4(+) T cells and the generation of a Th1-type adaptive immune response. WSX-1/IL-27R functions as a receptor for IL27. IL-27 not only contributes to the development of an adaptive immune response through its action on CD4(+) T cells, it also directly acts on cells of the innate immune system. WSX-1/IL-27R requires IL6ST/gp130 to mediate signal transduction in response to IL27. This signaling system acts through STAT3 and STAT1. It is involved in the regulation of Th1-type immune responses. IL-27R also appears to be involved in innate defense mechanisms. IL27RA is essential for transcriptional activation of STAT1 and for augmenting the induction of T-bet expression during initiation of Th1 cell differentiation.

References
  • Pflanz S, et al.. (2004) WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J Immunol. 172(4): 2225-31.
  • Yoshida H, et al.. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 215(4): 569-78.
  • Villarino A, et al.. (2003) The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection. Immunity. 19(5): 645-55.
  • Size / Price
    Catalog: HG10489-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"