Quick Order

Human IL1RL1/IL‑1 R4 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human IL1RL1 cDNA Clone Product Information
NCBI RefSeq:NM_003856.2
RefSeq ORF Size:987bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor-like 1, transcript variant 2 with C terminal Myc tag.
Gene Synonym:IL1RL1, T1, ST2, DER4, ST2L, ST2V, FIT-1, MGC32623
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.

References
  • Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.
  • Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"