After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IL-1R9/IL1RAPL2 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human IL1RAPL2 cDNA Clone Product Information
NCBI RefSeq:NM_017416.1
RefSeq ORF Size:2061bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2) with N terminal Myc tag.
Gene Synonym:IL1RAPL2, IL1R9, IL-1R9, TIGIRR-1, IL1RAPL-2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.

References
  • Jin H, et al. (2000) Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental retardation. Eur J Hum Genet. 8(2): 87-94.
  • Sana TR, et al. (2000) Computational identification, cloning, and characterization of IL-1R9, a novel interleukin-1 receptor-like gene encoded over an unusually large interval of human chromosome Xq22.2-q22.3. Genomics. 69(2): 252-62.
  • Gambino F, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104(21): 9063-8.
  • Size / Price
    Catalog: HG10156-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"