IL1RAPL1 cDNA ORF Clone, Human, N-His tag

Cat: HG10177-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL1RAPL1 Reagents
CRO Services
Product recommended

All IL1RAPL1 Reagents
IL1RAPL1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2091 bp
Description
Full length Clone DNA of Human interleukin 1 receptor accessory protein-like 1 (IL1RAPL1) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL1RAPL1 cDNA ORF Clone, Human, N-His tag Alternative Names
IL1R8 cDNA ORF Clone, Human;IL1RAPL cDNA ORF Clone, Human;MRX10 cDNA ORF Clone, Human;MRX21 cDNA ORF Clone, Human;MRX34 cDNA ORF Clone, Human;OPHN4 cDNA ORF Clone, Human;TIGIRR-2 cDNA ORF Clone, Human
IL1RAPL1 Background Information

Interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) is a member of interleukin-1 receptor family. The protein structurally comprises three extracellular immunoglobulin domains, which presumably mediate binding of an as yet unidentified ligand, a transmembrane region, and an intracellular domain, which is likely to enable signalling via the NFkB pathway. The means of signalling is almost certain to be identical to that used by the IL1R family and the more distally related Toll protein. L1RAPL1 protein physically interacts via its 150 aa C-terminal domain with neuronal calcium sensor-1 (NCS-1), a protein widely expressed in neurons and the related chromaffin and PC12 cells. IL1RAPL1 is an integral membrane protein responsible for a nonsyndromic form of mental retardation (MR). It is suggested to affect human cognitive ability to some extent, especially the memory and concentration capability.

Full Name
interleukin 1 receptor accessory protein-like 1
References
  • Frdric Gambino, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104 (21): 9063-8.
  • Wheway JM, et al. (2003) A complex deletion-inversion-deletion event results in a chimeric IL1RAPL1-dystrophin transcript and a contiguous gene deletion syndrome. J Med Genet. 40: 127-131.
  • IL1RAPL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL1RAPL1 cDNA ORF Clone in Cloning Vector, Mouse MG50900-G
    IL1RAPL1 cDNA ORF Clone, Mouse, untagged MG50900-UT
    IL1RAPL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50900-ACG
    IL1RAPL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50900-ACGLN
    IL1RAPL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50900-ACR
    IL1RAPL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50900-CF
    IL1RAPL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50900-NF
    IL1RAPL1 cDNA ORF Clone, Mouse, C-His tag MG50900-CH
    IL1RAPL1 cDNA ORF Clone, Mouse, N-His tag MG50900-NH
    IL1RAPL1 cDNA ORF Clone, Mouse, C-HA tag MG50900-CY
    IL1RAPL1 cDNA ORF Clone, Mouse, N-HA tag MG50900-NY
    IL1RAPL1 cDNA ORF Clone, Mouse, C-Myc tag MG50900-CM
    IL1RAPL1 cDNA ORF Clone, Mouse, N-Myc tag MG50900-NM
    IL1RAPL1 qPCR Primer Pairs, Mouse MP200871

    IL1RAPL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL1RAPL1 cDNA ORF Clone, Human, untagged HG10177-UT
    IL1RAPL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10177-ACG
    IL1RAPL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10177-ACGLN
    IL1RAPL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10177-ACR
    IL1RAPL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10177-CF
    IL1RAPL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10177-NF
    IL1RAPL1 cDNA ORF Clone, Human, C-His tag HG10177-CH
    IL1RAPL1 cDNA ORF Clone, Human, C-HA tag HG10177-CY
    IL1RAPL1 cDNA ORF Clone, Human, N-HA tag HG10177-NY
    IL1RAPL1 cDNA ORF Clone, Human, C-Myc tag HG10177-CM
    IL1RAPL1 cDNA ORF Clone, Human, N-Myc tag HG10177-NM
    IL1RAPL1 qPCR Primer Pairs, Human HP100245
    info info
    添加购物车成功! 添加购物车失败!