After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IL-1R8/IL1RAPL1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human IL1RAPL1 cDNA Clone Product Information
NCBI RefSeq:NM_014271.3
RefSeq ORF Size:2091bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor accessory protein-like 1 (IL1RAPL1) with N terminal Myc tag.
Gene Synonym:IL1RAPL1, IL1R8, MRX21, MRX34, OPHN4, IL1RAPL, TIGIRR-2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) is a member of interleukin-1 receptor family. The protein structurally comprises three extracellular immunoglobulin domains, which presumably mediate binding of an as yet unidentified ligand, a transmembrane region, and an intracellular domain, which is likely to enable signalling via the NFkB pathway. The means of signalling is almost certain to be identical to that used by the IL1R family and the more distally related Toll protein. L1RAPL1 protein physically interacts via its 150 aa C-terminal domain with neuronal calcium sensor-1 (NCS-1), a protein widely expressed in neurons and the related chromaffin and PC12 cells. IL1RAPL1 is an integral membrane protein responsible for a nonsyndromic form of mental retardation (MR). It is suggested to affect human cognitive ability to some extent, especially the memory and concentration capability.

References
  • Frdric Gambino, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104 (21): 9063-8.
  • Wheway JM, et al. (2003) A complex deletion-inversion-deletion event results in a chimeric IL1RAPL1-dystrophin transcript and a contiguous gene deletion syndrome. J Med Genet. 40: 127-131.
  • Size / Price
    Catalog: HG10177-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"