Quick Order

Human IL-1R8/IL1RAPL1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human IL1RAPL1 cDNA Clone Product Information
    NCBI RefSeq:NM_014271.3
    RefSeq ORF Size:2091bp
    cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor accessory protein-like 1 (IL1RAPL1) with N terminal His tag.
    Gene Synonym:IL1RAPL1, IL1R8, MRX21, MRX34, OPHN4, IL1RAPL, TIGIRR-2
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL1RAPL1 qPCR primers for gene expression analysis, HP100245 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) is a member of interleukin-1 receptor family. The protein structurally comprises three extracellular immunoglobulin domains, which presumably mediate binding of an as yet unidentified ligand, a transmembrane region, and an intracellular domain, which is likely to enable signalling via the NFkB pathway. The means of signalling is almost certain to be identical to that used by the IL1R family and the more distally related Toll protein. L1RAPL1 protein physically interacts via its 150 aa C-terminal domain with neuronal calcium sensor-1 (NCS-1), a protein widely expressed in neurons and the related chromaffin and PC12 cells. IL1RAPL1 is an integral membrane protein responsible for a nonsyndromic form of mental retardation (MR). It is suggested to affect human cognitive ability to some extent, especially the memory and concentration capability.

    References
  • Frdric Gambino, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104 (21): 9063-8.
  • Wheway JM, et al. (2003) A complex deletion-inversion-deletion event results in a chimeric IL1RAPL1-dystrophin transcript and a contiguous gene deletion syndrome. J Med Genet. 40: 127-131.
  • Size / Price
    Catalog: HG10177-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"