Quick Order

Text Size:AAA

Human IL-1R2/CD121b transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human IL1R2 cDNA Clone Product Information
NCBI RefSeq:NM_004633.3
RefSeq ORF Size:1197bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor, type I I, transcript variant 1 with C terminal Myc tag.
Gene Synonym:IL1R2, IL1RB, CD121b, MGC47725
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

References
  • Cannon JG, et al. (1997) Interleukin-1 beta, interleukin-1 receptor antagonist, and soluble interleukin-1 receptor type II secretion in chronic fatigue syndrome. J Clin Immunol. 17 (3): 253-61.
  • Liu C, et al. (1996) Cloning and characterization of an alternatively processed human type II interleukin-1 receptor mRNA. J Biol Chem. 271 (34): 20965-72.
  • Van der Poll T, et al. (1997) Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis. 175 (1): 118-22.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"