After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IL1F2 / IL1B ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL1B cDNA Clone Product Information
NCBI RefSeq:NM_000576.2
RefSeq ORF Size:810bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1, beta (IL1B) with N terminal His tag.
Gene Synonym:IL1B, IL-1, IL1F2, IL1-BETA
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-IL1B
Restriction Site:KpnI + XbaI (6kb + 0.9kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1B Gene Plasmid Map
Human IL1F2 / IL1B natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).

References
  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.
  • Size / Price
    Catalog: HG10139-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"