Quick Order

Human IL18RAP Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL18RAP cDNA Clone Product Information
NCBI RefSeq:NM_003853.2
RefSeq ORF Size:1800bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 18 receptor accessory protein with N terminal His tag.
Gene Synonym:IL18RAP, ACPL, CD218b, IL18RB, CDw218b, MGC120589, MGC120590
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin 18 receptor accessory protein, also known as IL18RAP and CDw218b (cluster of differentiation w218b), is an accessory subunit of the heterodimeric receptor for IL18. This protein enhances the IL18 binding activity of IL18R1 (IL1RRP), a ligand binding subunit of IL18 receptor. The coexpression of IL18R1 and this protein is required for the activation of NF-kappaB and MAPK8 (JNK) in response to IL18. IL18RAP is required for the high affinity binding of interleukin 18 (IL-18) to its receptor complex. IL18RAP together with IL18R1 mediates IL-18-dependent activation of NF-kappa-B and JNK. Two putative isoforms of IL18RAP were detected and the ratios and total levels of these isoforms may contribute to the aetiology of coeliac disease. IL18R1 and IL18RAP polymorphisms have been found associated with diseases such as schizophrenia, HSV1 seropositivity and atopic asthma. Analysis of IL18R1 and IL18RAP SNPs in 5 European prospective cohorts suggests that the variability of these genes are unlikely to contribute to modulate the risk of CVD in European populations.

References
  • Zhernakova A, et al.. (2008) Genetic analysis of innate immunity in Crohn's disease and ulcerative colitis identifies two susceptibility loci harboring CARD9 and IL18RAP. Am J Hum Genet. 82(5): 1202-10.
  • Grisoni ML, et al.. (2009) Lack of association between polymorphisms of the IL18R1 and IL18RAP genes and cardiovascular risk: the MORGAM Project. BMC Med Genet. 10: 44.
  • Koskinen LL, et al.. (2009) Association study of the IL18RAP locus in three European populations with coeliac disease. Hum Mol Genet. 18(6): 1148-55.
  • Size / Price
    Catalog: HG10176-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"