Quick Order

Human IL18R1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IL18R1 cDNA Clone Product Information
NCBI RefSeq:NM_003855.2
RefSeq ORF Size:1626bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 18 receptor 1 with C terminal Flag tag.
Gene Synonym:CD218a, IL18RA, IL1RRP, CDw218a, IL-1Rrp, IL18R1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-IL18R1-Flag
Restriction Site:KpnI + XbaI (6kb + 1.67kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL18R1 Gene Plasmid Map
Human IL18R1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Interleukin-18 receptor 1 (IL18R1) also known as CD218 antigen-like family member A, CDw218a, IL1 receptor-related protein and CD218a, is an interleukin receptor of the immunoglobulin superfamily. IL18R1 is found expressed in lung, leukocytes, spleen, liver, thymus, prostate, small intestine, colon, placenta, and heart, and is absent from brain, skeletal muscle, pancreas, and kidney. High level of expression is found in Hodgkin disease cell lines. This receptor is specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IL18R1 contains 3 Ig-like C2-type (immunoglobulin-like) domains and 1 TIR domain. It is a single-pass type I membrane protein. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. The increased expression of IL18R1 may contribute pathogenically to disease and is therefore a potential therapeutic target. The absence of a genetic association in the IL18R1 gene itself suggests regulation from other parts of the genome, or as part of the inflammatory cascade in multiple sclerosis without a prime genetic cause.

References
  • Nadif R, et al.. (2006) IL18 and IL18R1 polymorphisms, lung CT and fibrosis: A longitudinal study in coal miners. Eur Respir J. 28(6): 1100-5.
  • Haralambieva IH, et al.. (2011) Common SNPs/haplotypes in IL18R1 and IL18 genes are associated with variations in hum oral immunity to smallpox vaccination in Caucasians and African Americans. J Infect Dis. 204(3): 433-41.
  • Hulin-Curtis SL, et al.. (2012) Evaluation of IL18 and IL18R1 polymorphisms: genetic susceptibility to knee osteoarthritis. Int J Immunogenet. 39(2): 106-9.
  • Size / Price
    Catalog: HG11102-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human IL18R1 natural ORF mammalian expression plasmid, C-Flag tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"