Quick Order

Text Size:AAA

Human IL-17RD Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL17RD cDNA Clone Product Information
NCBI RefSeq:NM_017563.3
RefSeq ORF Size:2220bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 17 receptor D with C terminal His tag.
Gene Synonym:SEF, IL-17RD, IL17RLM, FLJ35755, MGC133309, DKFZp434N1928
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Interleukin-17 receptor D (IL-17D) also known as Interleukin-17 receptor-like protein, is a member of interleukine-17 recepter family. IL-17RD functions as a feedback inhibitor of fibroblast growth factor mediated Ras-MAPK signaling and ERK activation. It may inhibit FGF-induced FGFR1 tyrosine phosphorylation, regulate the nuclear ERK signaling pathway by spatially blocking nuclear translocation of activated ERK By similarity, and mediate JNK activation and may be involved in apoptosis. IL-17RD is found expressed in the neopallial cortex, rhombic lip and dorsal regions of the myelencephalon and in the frontal nasal process. IL-17RD is also expressed in the commissural plate and septal area of the forebrain and in the hippocampus, lens and optic cup. In the oral region, IL-17RD is expressed in the tongue and in the mesenchyme of the first branchial arch. It is also expressed in the developing inner ear. IL-17RD interacts with both IL-17R-Myc and IL-17RB-Myc. Both the intracellular and extracellular domains of IL-17RD interact with IL-17R. IL-17R forms a heteromeric complex with IL-17RD. Experiment results indicate that IL-17RD is able to affect IL-17R localization, suggesting that these two molecules are colocalized and associate with each other within cells. The fact that IL-17RD Delta ICD is unable to mediate IL-17 signaling but functions as a dominant-negative form indicates that the intracellular domain of IL-17RD is pivotal. In addition, IL-17RD interacts with the IL-17R downstream molecule TRAF6. It has been proposed that the IL-17RD intracellular domain interacts with IL-17R and TRAF6 to deliver the downstream signal.

References
  • Weaver CT, et al.. (2007) IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol. 25: 821-52.
  • Rong Z, et al.. (2009) IL-17RD (Sef or IL-17RLM) interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res. 19(2): 208-15.
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9(8): 556-67.
  • Size / Price
    Catalog: HG10507-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"