Quick Order

Human IL17BR / IL17RB / IL-17 Receptor B Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL17RB cDNA Clone Product Information
NCBI RefSeq:NM_018725.3
RefSeq ORF Size:1509bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal His tag.
Gene Synonym:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catalog: HG13091-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"