IL-17RE/IL17RE cDNA ORF Clone, Human, N-His tag

Cat: HG16052-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-17RE/IL17RE Reagents
CRO Services
Product recommended

All IL-17RE/IL17RE Reagents
IL-17RE/IL17RE cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2004 bp
Description
Full length Clone DNA of Human interleukin 17 receptor E with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-17RE/IL17RE Background Information
Full Name
interleukin 17 receptor E

IL-17RE/IL17RE cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IL-17RE/IL17RE cDNA ORF Clone in Cloning Vector, Rat RG81615-G
IL-17RE/IL17RE cDNA ORF Clone, Rat, untagged RG81615-UT
IL-17RE/IL17RE Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81615-ACGLN
IL-17RE/IL17RE cDNA ORF Clone, Rat, C-GFPSpark® tag RG81615-ACG
IL-17RE/IL17RE cDNA ORF Clone, Rat, C-OFPSpark® tag RG81615-ACR
IL-17RE/IL17RE cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81615-CF
IL-17RE/IL17RE cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81615-NF
IL-17RE/IL17RE cDNA ORF Clone, Rat, C-His tag RG81615-CH
IL-17RE/IL17RE cDNA ORF Clone, Rat, N-His tag RG81615-NH
IL-17RE/IL17RE cDNA ORF Clone, Rat, C-HA tag RG81615-CY
IL-17RE/IL17RE cDNA ORF Clone, Rat, N-HA tag RG81615-NY
IL-17RE/IL17RE cDNA ORF Clone, Rat, C-Myc tag RG81615-CM
IL-17RE/IL17RE cDNA ORF Clone, Rat, N-Myc tag RG81615-NM

IL-17RE/IL17RE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL-17RE/IL17RE cDNA ORF Clone in Cloning Vector, Human HG16052-G
IL-17RE/IL17RE cDNA ORF Clone, Human, untagged HG16052-UT
IL-17RE/IL17RE cDNA ORF Clone, Human, C-GFPSpark® tag HG16052-ACG
IL-17RE/IL17RE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16052-ACGLN
IL-17RE/IL17RE cDNA ORF Clone, Human, N-GFPSpark® tag HG16052-ANG
IL-17RE/IL17RE cDNA ORF Clone, Human, C-OFPSpark® tag HG16052-ACR
IL-17RE/IL17RE cDNA ORF Clone, Human, N-OFPSpark® tag HG16052-ANR
IL-17RE/IL17RE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16052-CF
IL-17RE/IL17RE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16052-NF
IL-17RE/IL17RE cDNA ORF Clone, Human, C-His tag HG16052-CH
IL-17RE/IL17RE cDNA ORF Clone, Human, C-HA tag HG16052-CY
IL-17RE/IL17RE cDNA ORF Clone, Human, N-HA tag HG16052-NY
IL-17RE/IL17RE cDNA ORF Clone, Human, C-Myc tag HG16052-CM
IL-17RE/IL17RE cDNA ORF Clone, Human, N-Myc tag HG16052-NM
info info
添加购物车成功! 添加购物车失败!