IL-17D/IL17D cDNA ORF Clone, Human, N-His tag

Cat: HG16051-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL-17D/IL17D Reagents
CRO Services
Product recommended

All IL-17D/IL17D Reagents
IL-17D/IL17D cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Human interleukin 17D with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-17D/IL17D cDNA ORF Clone, Human, N-His tag Alternative Names
IL-17D cDNA ORF Clone, Human;IL-27 cDNA ORF Clone, Human;IL27 cDNA ORF Clone, Human
IL-17D/IL17D Background Information
Full Name
interleukin 17D

IL-17D/IL17D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL-17D/IL17D cDNA ORF Clone in Cloning Vector, Mouse MG50108-M
IL-17D/IL17D cDNA ORF Clone, Mouse, untagged MG50108-UT
IL-17D/IL17D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50108-ACG
IL-17D/IL17D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50108-ACGLN
IL-17D/IL17D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50108-ACR
IL-17D/IL17D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50108-CF
IL-17D/IL17D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50108-NF
IL-17D/IL17D cDNA ORF Clone, Mouse, C-His tag MG50108-CH
IL-17D/IL17D cDNA ORF Clone, Mouse, N-His tag MG50108-NH
IL-17D/IL17D cDNA ORF Clone, Mouse, C-HA tag MG50108-CY
IL-17D/IL17D cDNA ORF Clone, Mouse, N-HA tag MG50108-NY
IL-17D/IL17D cDNA ORF Clone, Mouse, C-Myc tag MG50108-CM
IL-17D/IL17D cDNA ORF Clone, Mouse, N-Myc tag MG50108-NM
IL-17D/IL17D qPCR Primer Pairs, Mouse MP200138

IL-17D/IL17D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL-17D/IL17D cDNA ORF Clone in Cloning Vector, Human HG16051-G
IL-17D/IL17D cDNA ORF Clone, Human, untagged HG16051-UT
IL-17D/IL17D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16051-ACGLN
IL-17D/IL17D cDNA ORF Clone, Human, C-GFPSpark® tag HG16051-ACG
IL-17D/IL17D cDNA ORF Clone, Human, C-OFPSpark® tag HG16051-ACR
IL-17D/IL17D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16051-CF
IL-17D/IL17D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16051-NF
IL-17D/IL17D cDNA ORF Clone, Human, C-His tag HG16051-CH
IL-17D/IL17D cDNA ORF Clone, Human, C-HA tag HG16051-CY
IL-17D/IL17D cDNA ORF Clone, Human, N-HA tag HG16051-NY
IL-17D/IL17D cDNA ORF Clone, Human, C-Myc tag HG16051-CM
IL-17D/IL17D cDNA ORF Clone, Human, N-Myc tag HG16051-NM
info info
添加购物车成功! 添加购物车失败!